martes, enero 31, 2012


"Chupa si quieres follar"
                        Harold Robbins "El descenso de Xanadú"         

Levi está dándose al drinking, un tanto desesperao y deseando tanto o más que yo el que acaben estos días prevacacionales para volver a su cancaneo habitual. Ahh, no sé, le veo mucho más sugerente así mal afeitado y con ese brillo como de desesperación en la mirada, así que me siento a la mesa y compongo una sonrisilla que espero él agradezca.
"Que tal, muchacho...¿no estás emocionado?...ya solo quedan dos días de mutua convivencia y luego yo seré libre durante una quincena y tú, libre para los restos." hay manera, me da la espalda y bufa por lo bajo, está enfadado y puede que con razón. Así que insisto. "Levi, guapetón. Que llevas aquí casi una semana y no nos hemos conocido ni hemos hablado de nosotros mismos ni nada. Es una pena, ¿no crees?"
Levi me mira de reojo, resopla otra vez y se repantinga más en su butaca sin decir ni pío.
"Qué te pasa, que estás mosqueao por lo del tiburón. Pero si es todo virtual, hombre, lo viste y te dio susto, pero luego nada, ¿a que no?" le digo amistoso esperando que no me enseñe una de sus piernas amputada a la altura de la rodilla. 
Gracias al cielo no lo hace, se termina la copa de un trago y en lugar del muñón se pone en pie y ¡saca "la pichota" !(véase entrada del día anterior)...luego, componiendo la misma mueca lasciva que supongo mostraría Lady Chatterley cuando se enroscaba la braga en el tobillo, se lame el labio superior y susurra:
"Bobito encantador. Cómete esta piruleta y luego veremos si papá cree que has sido bueno y te pone su cachiporra en algún sitio oscuro y ajustado que se nos ocurra a los dos...tu ya me entiendes..."
Quien iba a decir que Levi poseía esa capacidad para la improvisación de literatura porno de bolsillo. Yo desde luego no, me quedo con la boca abierta en tal actitud que Levi, confundido, sonríe para sí mismo con cara de "ya-sabía-yo-que-este-terminaba-tragando-fijo", e impulsa su pelvis en dirección a mi boca pensando que va a encontrar allí acomodo...yoasustado reculo, él llevado por la inercia no puede frenar, mi silla bascula sobre dos patas, se inclina hacia atrás, se inclina, se inclina...
...y aquí estoy tirado en el suelo con Levi sentado sobre mi cara, sus testículos en mi nariz, su orto incómodamente -al menos para mi- apretado contra los morros y una estúpida expresión en su rostro como si acabase de comprender el funcionamiento de la montaña rusa.

...creo que en este momento necesitamos todos unos minutos musicales...y qué mejor que con este video que a mi querido Mr.G le recordará nuestras ya lejanas vacaciones veraniegas. En él buena parte del plantel de actores de Randy Blue ( una compañía dedicada a la entretenida labor de rodar películas porno ) hace un creo yo que divertido y entrañable homenaje a Kylie Minogue...

...y en lo que respecta a Levi, tranquilidad, tengo el asunto totalmente controlado, ¿vale?

...vamos, me parece...

lunes, enero 30, 2012

LEVI 501???

...mi invitado, el número de no fuese porque sé que soy mucho más brillante e ingenioso que todo eso, pensaría de mi mismo que esta gansada está orquestada con toda la idea, ¡y no, jaja, de veras que me acabo de dar cuenta!...

..pero en fin, aquí estamos, y en virtud de la magia de este mi espacio que actua como cámara de espacio-tiempo tal cual si fuese la mismísima Tardis del Doctor Who, pues me encuentro abandonando los fríos y un tanto tristes confines de mi espacio urbano habitual para zas, plantarme con el Levi en una hermosa playa, con el cielo azul sobre la espalda y una cálida brisa marina acariciándome la cara. 

Suena maravilloso, el universo paralizado en un radiante mediodía con el mar azul delante y un peazo bollo como Levi mirándome con cara de circunstancias ahí al lado ataviado nada más con un minúsculo slip blanco....pero no estoy por la labor, no porque no pierdo de vista la movida espacio-temporal, con mi trabajo nocturno ando funcionando en "modo vampiro" y toda esta claridad me confunde y me hace desear volver de inmediato a mi localidad invernal con el número de horas de sol limitadas y además filtradas casi todo el rato por una espesa capa de nubes.
"Playita ahora no, Levi. Me trasloco de nuevo si no te importa, que me he de echar la siesta para poder correr esta noche fresco como una lechuga a los brazos de Mr. G", le digo tratando de ser amable porque veo que el chaval ha hecho un esfuerzo para llevarme al huerto.
Levi, jugándose todas las cartas, se agarra la generosa entrepierna y me suelta componiendo un puchero con los morritos:
"Ñu-ñu-ñu. Y que hago yo ahora con esta pichota."
"Pichota", murmuro para mi sin dar crédito a mis oidos. Después compongo una sonrisa profesional y  sugiero:
"¿qué tal ponerla a remojo?...el agua debe de estar buenisima."
"Bien, pues si está tan buena BÉBETELA TODA", contesta con mucho resquemor y mucha malicia.

No me gusta ser así, pero en virtud a mi omnipotencia bloguerística, coloco al Levi a remojo, le pongo un divertimento...

...y me vuelvo a la realidad circundante...que es mi antepenúltima noche antes de las vacaciones y empiezo a sentir ese ánmo loco de "al-diablo-con-todo" que le entra a uno cuando va a disponer de quince días de su vida y de su tiempo para emplearlos como uno quiera...¡en qué mundo vivimos, que nos hace celebrar el tiempo que nos podemos dedicar en exclusiva aunque no hagamos más que sentarnos a mirar por la ventana como discurre la luz del día?...

...he de convencer a Levi para posar en bolingas y justificar un poco su paso por este espacio, porque si no, no sé a qué me estoy dedicando estos días...

...lo tengo medio apalabrao, ya verás...aunque después de lo del tiburón, no sé yo, ha-ha-ha...

domingo, enero 29, 2012


...¡¡¡¡el número me ha pillado de sorpresa!!! Pensaba seguir toda la semana con las tonterías justas entre Levi y yo para vacilar ante todo un poco conmigo mismo y distraer la sobremesa en mi propia compañia pero ¡canastos!, no esperaba que un día tan imprevisto fuese a ser el día que mi blog alcanzase la cifra de 500 entradas...

"Ah, entonces hoy vas a dedicar el día a mirar el  ombligo que posees en esa mullida barriguita y otra vez voy a desfallecer aquí metido de puro aburrimiento" dice Levi en postura de desidia total.
...pues hombre, Levi, como no voy a dejar unas palabras conmemorativas.
"No te preocupes, tengo el ipod enganchado al elástico del calzoncillo, escucharé a Selena Gomez mientras tu te regodeas contigo mismo e intentaré no morir de hastío mientras tanto"

...bien, pues en realidad no hay mucho que decir. 

Lo mejor que puedo decir sobre mi espacio es que ha sido absolutamente mio, ¡cosa que no puedo decir en el resto de los ámbitos de mi vida!. A ratos ha sido casi un diario personal, a ratos un lugar público en el que creo que me he preocupado en exceso del sentimiento de los ojos que leían mis palabras. A ratos lo he utilizado como laboratorio para "experimentos literarios" y a ratos como plataforma para enviar mi amor y mi afecto a personas especiales que no estaban a mi alcance. 
Ha cambiado como he cambiado yo y en cierto modo hoy siento que he trazado un círculo y me veo escribiendo aquí como escribía mis diarios y mis historias inventadas a los quince años, escribiendo por el mero placer de hacerlo y olvidando a cada minuto el folio que había escrito el minuto anterior, porque nada más era algo que quería "vaciar" de mi cabeza en un momento dado y, una vez vaciado, podía olvidarlo por completo y seguir con lo que sea que estuviera haciendo.

Pero no, hay cierta trampa en ese argumento porque si lo escribo y lo guardo, en un cajón o apretando aquí el botón de "guardar" es porque no deseo olvidarlo por completo, y sé que en el futuro enredaré en estos cajones y me gustará leer mis palabras porque como en esa película de "El efecto mariposa" en la que el protagonista leyendo sus propios diarios es capaz de retroceder al pasado, yo me siento capaz de releerme y recrear sentimientos y actitudes como si no hubiesen transcurrido años de por medio...

Total, que siguiendo mi política de hacer lo que me da la santa gana, jaja, voy a dejar el enlace aquí de las tres entradas favoritas que me vienen ahora a la cabeza de estos seis años, para propios, extraños y por supuesto para mi disfrute personal. Entradas que no sé porqué recuerdo y que supongo que si vienen siempre a mi cabeza será por algo:

...sí, aquellos caballos galoparon pero a pesar de todo lo que parecía, cabalgaban hacia el anochecer.

...a saber porqué me acuerdo de esto, pero también fue el primero que me vino a la cabeza a la hora de escoger...

...así, en un pack, porque sin darme cuenta preparaban el advenimiento de Mr. G. y toda la felicidad que vino después... me fue la tarde mirándome el ombligo como dice Levi y he de retirarme a mi siesta necesaria para llevar con donosura la noche de trabajo. 
Mañana será otro día, pero hoy...

¡FELICIDADES, VOLANDO A RAS DE SUELO!... gracias por todo lo compartido, lo soñado y lo realizado...

...espero estar aquí igual de bien cuando toque celebrar los 1000...

Y para que Levi no me pida la cuenta, aquí le dejo a su Selena con el nuevo hit tras el "love-you-like-a-love-song-baaaabyyyyyy"...

sábado, enero 28, 2012


Luz invernal entrando por la ventana, pero una cálida atmósfera en el interior.
Dos copas de vino medio vacías sobre la mesa.
Levi, perezosamente tumbado en la chaise-longue, se desabrocha el primer botón de los pantaloncitos y hace un morrito.
"Entonces dices que estás entregado emocional y fisicamente a ese mister-no-sé-cuantos." pone un momento los ojos como platos, exclama con voz aguda "¡FISICAMENTE!" y ríe como una vicetiple en mitad de un número picante."Pero chico, estás out total. ¿Y que vamos a hacer entonces toda la semana, jugar a las palmitas?"
Resoplo un poco tenso, porque hombre, no es que pensase que durante estos días en que tengo contratao al Levi fuésemos a estar hablando del sentido de la vida o haciendo ejercicios de filosofía kantiana, sé que Levi es un chico alegre con muchos pájaros en la cabeza ( y uno bien gordo en el gallumbo, ha-ha-ha ) pero no pensaba creía qu...¿para qué cojones traje al Levi?...
"Bueno, Levi, puedes empezar por contarnos un poquito de tu vida, esas cosas que se cuentan en las entrevistas, qué sé yo...¿tuviste una infancia dichosa? ¿has sido siempre asi de cachas o te has tenido que pulir un poco en el quirófano?"
Levi vuelve a fruncir ese piquito, se desabrocha otro botón de los minishorts dejando ver unos pelillos rizados y castaños que estimulan de pronto mi sudoración ( alguien debe hacer un estudio sobre la visión de ciertos pelos y el incremento de pulsaciones y todo eso ) e introduciendo los dedos en ese antro de perdición que son los pantaloncillos exclama:
"Oh, cielos, hay algo a punto de churruscarse aquí abajo...¿tendré un acceso de fiebre localizada  justo AHÏ? ¿estarán estos casos documentados por la ciencia?..."ahora recompone el gesto de pin-up cachonda y gimotea "por favooor, mister Doctorrrr, esto parece caliente e hinchado, quizás deba usted ponerme el periscopio"
"El termómetro. Quieres decir el termómetro" susurro sin dar crédito a lo que estoy presenciando.
"No, no quise decir termómetro, lo que quise decir es...
...Levi salta como un lagarto con las manos en jarras como si fuese a detener un balón localizado en mi entrepierna,yo retrocedo agilmente y Levi da con sus morros contra el suelo, circunstancia que yo aprovecho para huir y cerrar el post de hoy, mientras escucho los gritos de Levi ahí dentro
Cáscaras...¿que especie de alimaña estoy cobijando en mi regazo?...

viernes, enero 27, 2012


...a falta de una semana ya escasa para mis vacaciones invernales ( seis días de trabajo nocturno )...

Y no queriendo repetir mi proeza como capitán-navegante de Julio a pequeña escala, me he decidido por amenizar la espera en compañía de este bello caballero, dado que la pobreza de mi monocroma rutina iba a dar para poco por si misma. Pues bien, mi invitado-huésped para esta semana es Levi Poulter, un modelo que está catalogado como "el más bello del mundo" no solo por su mamá y por su abuelita, sino también por gente experta que se fija en más cosas que las pulsiones sexuales de uno mismo ( como me ocurre a mi ) a la hora de valorar esta cuestión, ha-ha-ha.

¿Que menos que el más bello para volar conmigo a ras de suelo una semanita?...

...yo sé que a Mr. G este no le va a gustar mucho, y que prefiriría que me hubiese sacado a Jack un rato de la isla de "Perdidos" para sacarle jugo estos días, pero en fin, Jack tenía la agenda a tope, solo teníamos a Levi disponible, seamos corteses con él...

...en fin, solo decir hoy que a pesar de las inminentes vacaciones tengo un poco de bajón sobre todo provocado por la profunda crisis invernal climatológica que estamos padeciendo. La oscuridad y el frío solo consiguen hacerme sentir deseos de dormir, incluso aquí retransmitiendo mi post con Levi al lado ataviado solamente con unos calzoncillos de Calvin Klein.

"Levi, chato, ¿te importa sacarte los boxer y mostramos a la concurrencia una foto en plan perrito caliente tu-de-bollo-y-en-medio-la-salchicha ?"

...ah, se limita a reir recatado y mirar para otro lado...ya caerás, perrón, jejeje...pero bueno, nos estamos conociendo, ya veremos como termina esta aventurilla.

Entretanto, hoy noche, amenaza de nieve, y...y...


lunes, enero 23, 2012


Que falta de credibilidad inspira el amor hoy en día.
Porque nadie confiesa estar enamorado,todo el mundo cree que eso son filfas, y los que SÍ dicen amarse resultan a veces tan estomagantes que en su interior, los incrédulos y reacios se dicen a si mismos "si estar enamorado implica ser así como son esos, qué bien estamos como estamos".
Principalmente cuestionamos su durabilidad. Como si el amor no tuviese que estar sujeto a la caducidad de todas las cosas que nos rodean para ser verdadero y creíble.
¿Porqué no pueden ser posibles noches de amor inolvidables con un/a desconocido/a a quien no volvamos a ver más?¿Y porqué no puede ser sincera la verdadera ternura con la que a veces se contemplan dos ancianitos viejísimos que pasean por la calle?
"Bah, porque eso ya no es amor, como tú dices es ternura."
¿Y porqué el amor no va a regularse a lo largo de la vida en su cualidad, su claridad y su potencia?
Sobre todo "claridad" porque cuando la realidad se pone espesa, cuesta ver, y sentir, y encontrar la mano que queremos retener entre la nuestra para hacer más bello el camino.
A buen seguro no hay forma de definirlo ni adecuarlo a la experiencia de cada persona porque el amor es así, humo entre los dedos, algo a lo que por mucho que te empeñes no puedes dar el color ni la consistencia ni la forma que tú y tu fe y tu deseo de seguridad desearíais. De hecho creo que en la mayoría de los casos escapa al control de quienes lo viven, y a veces muere al instante cuando tenía todas las condiciones para crecer hermoso, y otras parece que no va a sobrevivir y en cambio se mantiene como un hálito suave entre los labios y una melodía suave como música de fondo de la vida.
No sé.
Yo, avanzando Enero tan frío y con tantos meses por delante que el alma necesita llenar de algo, tengo que creer y de hecho creo en este amor. Un amor en el que no pienso, un amor que no me planteo, un amor que crece sin restricciones ni condiciones en un lugar donde es dificil que pueda crecer nada. Ya he hablado mucho de mi amor en este espacio, y por mucho que lo mire y lo analice, cada vez que lo contemplo no me puedo creer que haya podido yo ser tan afortunado.
Lo que siempre deseé. 
Ahora releo aquellas antiguas entradas etiquetadas como "el amor que vendrá" y releyéndolas hoy he visto que cada una de aquellas palabras era para ti.
¿Como no voy a creer en el amor?
...como melodía para hoy, un nuevo tema de Lana del Rey, mi reciente inspiración musical, con este maravilloso tema, "Born to die":

miércoles, enero 11, 2012


Sin nada llamativo ni especial que ponerle ni quitarle.
En estos momentos primeros del año soy muy proclive a leer libros de autoayuda, de esos que le inspiran a uno para abrazar su realidad y sentirse bien con el estado personal de las cosas, haciéndote luchar con ese instinto básico humano de pensar que tu vida es una porquería y con la famosa frase de "porqué precisamente a MI me tocó ser YO". 
No sé a ti, pero a mi cuando empiezo el año no me da por hacer propósitos nuevos sino por ponerme a pensar en como estoy ahora y como podría estar si no hubiese hecho las cosas como las he hecho. Pensamientos nada constructivos, he-he-he, pero son tan inevitables como el ciclo de las estaciones, y no hay que preocuparse porque con un poco de suerte allá cuando termine el mes ya me habré calzado del todo la camisa nueva del 2012 y estaré medio a gusto con ella.
O como mucho a primeros de Marzo...
Así que dado que no hay nada que contar y con poco que hacer antes de la siesta, me he puesto a buscar una canción ( "¿ooootra canción?...¡preferimos los hombres desnudos!" ) dirá el estimable público, jaja, pero no, hoy no hay hombre desnudo que valga. Tenía especial interés por rescatar de mi particular anonimato cultural esta canción que me resultó una increíble y adorable sorpresa en el comienzo de la segunda temporada de "LOST" ( "Perdidos" ), y gracias a esta maravilla de los interneses he localizado en 0'0 segundos.
Se trata de este precioso tema de The Mamas and the Papas, portentoso grupo vocal de la década de los sesenta que además de dejar conocidísimas joyas musicales gordas cual pedruscos como "California Dreamin'", interpretó muchos temas menores -"menores" por quizás "menormente conocidos"-. Entre ellos está la siguiente canción, "Make your own kind of music" que me dejó maravillado, no sé si por si misma o por escucharla de forma insospechada en la misteriosa selva de los "Perdidos"...vamos allá con ella, y a componer con su ayuda una sonrisa para el míercoles. 
Eso a vosotros, yo para las sonrisas ya tengo a Mr. G, con él me río de las cuestas de Enero y de lo que me pongan, ha-ha-ha...
Feliz día a todos...

PD, el día siguiente:...corrección a la nota cultureta del día. "Make your own kind of music" no fue grabada por el grupo "The Mamas and the Papas" sino por nada más una de sus componentes, Cass Elliot, en un album en listillo, que eres un listillo...

martes, enero 10, 2012


...pues al fin el no tener a la vista las actualizaciones de las páginas que me interesan me echó para atrás un poco a la hora de quedarme con el formato "magazin" y he vuelto a una vista simple tradicional, sin otra intención que darle al tema un colorcillo gris que parece el pertinente en plena cuesta de Enero...que ¡vaya cuesta!, no hablo yo aquí casi nunca de coyunturas económicas pero todo el mundo tiene en la boca allí a donde vas lo mal que están las cosas, y la crisis, y el desempleo, y los "ERE",y...y en medio de todo eso yo, pretendiendo vivir en mi galaxia virtual e inventándome formas de escapar de la oscuridad real con ángeles, cancioncillas e imágenes de hombres tirando a velludos ligeros de ropa pues...pues me resulto a mi mismo banal y prescindible, ¡qué te voy a decir!. 
Pero siempre me ha ocurrido que cuando los que están alrededor se empeñan en decirme o querer demostrarme que lo que estoy haciendo o no interesa o no sirve para nada, pues más me empeño yo en hacer justo todo eso que dicen que no va a ningún sitio, aunque el tiempo me demuestre que terminan teniendo razón.

De ahí que para inaugurar la definitiva -digo yo- imagen de mi blog para esta temporada mía de "hombre-a-la-espera-de-la-primavera", lo haré con dos de las cosillas que me dan alegría: 

La primera, Lana del Rey, mi descubrimiento musical para el 2012. Una muchacha cuya carrera se ha desarrollado a expensas de todos estos rollos del youtube y las redes sociales y los interneses, que cuenta con una peculiar voz profunda y que sube videos elaborados por si misma a base de recortes que encuentra por ahí y retazos de su , por llamarlo de algún modo, imaginario personal.

Esta canción me fascina:

Y en segundo lugar para festejar este martes de inauguración, pues un bollo. 
Debo decir, por si antes no había dado este dato, que todos los machotes que ilustran este espacio lúdico-recreativo son en su mayoría actores porno-gay de los cuales si alguien tiene interés puede encontrar sus andanzas en cualquier otro espacio también lúdico-recreativo internetístico. "Ah, pues yo pensaba que era el equipo de hockey de tu instituto" dirá lgún incauto...¡pues no! ¿Y porqué dedicados a ese tipo de actividad?...Pues fíjate, porque aún sabiendo que no voy a catar ni a los unos ni a los otros, me resulta más atrayente disfrutar con la contemplación de organismos pluricelulares que al menos en apariencia responden a los mismos estímulos que los míos. Y que si reventando la ley de probabilidades uno de ellos y yo coincidiésemos en algún sitio a oscuras y con mucha hambre atrasada ( hambre ellos, a mi me valdrían también incluso como postre tras un almuerzo copioso, jaja ), pues YO tendría "una posibilidad", que no existiría si por ejemplo, me viese en el mismo sitio a oscuras con el David Beckham que bueno como está ya ha dejado claro que prefiere el repollo y no el pepino, a la vista de todos los nenes que le ha hecho ya a la spice-girl esa con la que anda...
Pero dejando de lado frivolidades carnales, además ahora -tardíamente- reparo en que lo mínimo que puedo hacer por estos chicos que ceden sin quererlo su bella imagen a mi espacio es ¡poner su nombre! para que podais buscarlos, compararlos y que se hagan un hueco en el mundo de la fama: por eso digo que el muchacho de hoy se llama Levi Poulter y además de alguna cosilla que le pica ahí abajo, tiene un body el tio que si te tiras en plancha sobre él desde lo alto del armario lo más probable es que rebotes y termines en el patio interior colgado del tendedero de la vecina y llamando a tu mamá.

Muéstraselo, Levi:

...aj, que quereis, si no soy yo frívolo conmigo mismo, a ver quien va a serlo...

lunes, enero 09, 2012


...que poco preparado estoy para retomar las rutinas y las labores en el punto en que quedaron hace un par de semanas o tres...
...entretanto sigo experimentando con el Blogger, a punto de descartar el formato "magazin" porque con este desaparece la lista de páginas favoritas y ahora no sé donde buscar para ver si hay actualizaciones.
Con un poco de dolor de cabeza y de nuevo, necesidad como de dormir mucho rato y muy seguido...

Dejo la foto de un chulazo y me voy a la siesta. Ya que la despiadada cotidianeidad no nos da tregua ni aparentes alegrías, que no se diga que no hago yo lo posible para animar el ojo de mis lectores.
¿Es este mi futuro bloguero, una versión sin chicha ni limoná del playgirl en la que la única sustancia serán tíos cachotas a punto de quitarse el calzoncillo?
Uff, que lunes tengo.

domingo, enero 08, 2012


( Nota: pincha en foto o en título. Si no haces nada verás solo las primeras líneas de la entrada. Es por mi mismo y más gente como mi amor Mr. G, que si no nos perdemos para verla entera, ¿si?...ahora ya, dale )

(Nota 2: mira, con pinchar en la foto del chorbo, también vas a la entrada completa...¡¡¡cielos, me temo que una vez visto el chorbo nadie quiera leer la entrada completa!!!...bueno, estoy en fase de pruebas, ya lo dije, ¿no? )

...aah, pues no sé, voy a probar unos días estas "vistas dinámicas" de blogger porque me parece bastante chulo ver todas las tonterías que he dicho en los últimos quince días así en formato moderno como si fuesen cosas importantes, jajajaja...pero bueno lo mejor es esto ( dedicado a usuarios poco acostumbrados y sorprendidos como yo ante estas cosas, y por supuesto a Mr. G que siempre agradece un poco de orientación en estos temas) : 
si ahí, debajo del título "volando a ras de suelo" pinchas en "classic" pues obtendrás una visión muy similar a la tradicional, esa en la que mis cosas no parecían cosas importantes, jaja...
...pero agarra y pincha en "FLIPCARD"....¡CARAJOS, ES UN FLIPE!"...porque según pones la flechita encima de cada imagen, se da la vuelta y te muestra la entrada a la que se refiere y si pinchas ahí pues allí que te vas...increíble,no solo eso sino la cantidad de individuos en pelotas que he puesto, ¿estoy a un paso de la categoría de "enfermo"?...
...ahora, pincha "MOSAIC", y te aparecen todas las imágenes de mis últimas entradas formando un bonito collage ( de tios en bolas, ha-ha-ha ), y de la misma forma pinchando en una te vas a la entrada original...¡que bonito! opción "SIDEBAR" pues bueno, es funcional y práctica pero me parece como poco chula, chico...
..."SNAPSHOT" es bastante chula, pones la flechita encima y la imagen se acerca y te muestra la referencia...pero no sé, después del flipecard y el mosaic, pues me sorprendí menos.
...y "TIMESLIDE" es también práctico como el sidebar pero vamos, yo creo que debo ordenar a mis usuarios que se limiten al uso del "magazine", el flipecard y el mosaic-guay, hahaha...
Y todo esto porque a Mr.G no le gustó el diseño de ayer, ¿viste?
Este chico hace conmigo lo que quiere, jejeje...naaa es brooooma, pero en fin, dado que este domingo de enero es ya así, sin navidades ni reyes ni nada y tenemos a punto de empezar la famosa cuesta del mes antes mencionado y con el primer lunes duro-duro a la vuelta de la esquina, pienso que lo mejor es ilustrar la desoladora escena con algo calentico, y ¿qué mejor que esta imagen de Leo Giamani?
Leo es un bombero retirado que después se dedicó a actor en películas no aptas para todos los públicos y orientadas a caballeros a los que les apetece ocasional o habitualmente practicar sexo con otros caballeros y por tanto pueden encontrar estimulante el visionado de telefilmes en los que basicamente se muestran diferentes momentos de la cópula entre hombres ( cielos, para decir que hacía pelis pornogays como me enrollé, si parezco el Rajoy ha-ha-ha )...bueno y tras decir -por si su reputación de macho estaba en entredicho, digo yo- que era bisexual creo se retiró del mundo del chou-bisness pero no sin antes dejar joyas de imágenes como esta.
Que burro me ponías, Leo.

Eso es un paquete, y no lo que llevan los Reyes en camello, jajajaja...
¡¡¡Feliz vuelta a la dura rutina a todos!!!

sábado, enero 07, 2012


...en pruebas...

...ando de rebajas a ver si me hago con un diseño que cuadre con el ánimo cucarachero que me suele acompañar el mes de Enero. No me gustan las Navidades pero cuando se termina toda la movida festiva, me quedo un poco chuchurrío y con pocas ganas de encarar toooodos esos meses que me quedan por delante.

Como terapia, bueno es estrenar algo y hacer el melón un rato con el diseñador de plantillas del Blogger que a pesar de lo fácil que lo pintan, siempre me termina, como se suele decir, rompiendo las pelotas: ¿Alguien sabe porqué me sale la foto de la cabecera chiquitica y no de lado a lado? ¿es por el diseño de plantilla que he escogido?...

...bueno, mientras solventamos esta etapa de transición, dejo un chulazo con colores a juego con el nuevo formato, ha-ha-ha.

Tras Navidades, Nocheviejas y Reyes... feliz retorno al mundo real.

jueves, enero 05, 2012


...aaaahhh, creo que mi dia favorito de las Navidades es la víspera de Reyes. ¿Porqué?...pues no sé. Hay tanta gente por ahí conspirando en secreto y tramando felicidad para las personas que quieren...yo creo que todo ese terrorismo positivo que mañana por la mañana explota y pone perdidas las casas de sonrisas y abrazos pues embellece la atmósfera momentáneamente.
Yaaa, yaaa, escucharemos la voz de la monjita de la primera fila que nos recuerda que hay muchos hogares y niños que no han podido permitirse frívolos despilfarros en estos tiempos de achuche que corren y tal. Gracias, nadie pierde de vista que la situación está jodida nos pongamos como nos pongamos. Pero eso no resta un ápice de bueno al asunto de que quien sí se lo ha podido permitir, regale aunque sea una bolsa de caramelos o una caja de pinturas o una horrorosa corbata a la persona que quiere, y ponga un instante de calidez en el corazón del que recibe y reciba a cambio un beso o una muestra de afecto.
Trascendido lo económico y lo mundano, ese intercambio de amor en forma de símbolos que toman la forma material que a cada uno se le ocurre, es a mi entender lo beeeeello de la cuestión.
Y a modo de regalo onanista y autosatisfactorio, me voy a permitir el pequeño horror de recordar qué escribí yo los anteriores años tal día como hoy. 
Voy sin previo aviso, no sé somo terminaré, ha-ha-ha.

2011: en esa reciente Navidad, disfrutando ya del amor de Mr. G, mi ánimo era optimista y dejaba ahí el último capítulo de unos preciosos desvarios navideños ( pinchese en "desvaríos" para consultar).

2010: ( en que hora se me ocurrió, esto anda lento cual vaca rumiando la digestión )...este año no se inmortalizó la fecha, estaría demasiado ocupado con alguna cuchufleta, jeje...

2009:...cáscaras, tampoco hay nada...otro año con demasiadas cosas en la cabeza, seguro...¿pero no era mi fecha favorita?...

2008: En la era pre-Mr. G que a mis efectos es como un pasado borroso en el que los dinoplodocus correteaban por la tierra. ¿Qué hacía yo antes de ser feliz con este hombre?...pues mira, haciendo gala de sensibilidad y un toque de cursilería divina, demoré un día -esto es, el día 6- para hablar de "regalos que importan". Que bonito soy, jeje. ( pinche en regalos para comprobar mi bonitidad, jaja)

2007: Esta es más en mi línea, dedicada al cuerpo de bomberos de Burgos que me alegraron el ojillo tal noche como, no me lo alegraron tanto como yo hubiera querido, jaja, pero ahí está el testimonio...( ahora pinche en testimonio y si no más, por lo menos verá un chulazo atractivo en la cabecera )

2006:...cielos, estamos hablando cuando organismos protozooarios pululaban por las aguas primigenias del planeta haciendo como que no hacían pero haciendo a pesar de todo...tanto hace que este blog ¡todavía no existía! peeero, he aquí la primera entrada de dos semanas después, para los coleccionistas y curiosos, AQUÍ.

...mientras escribía estas líneas ha anochecido, habrá arrancado la cabalgata de SSMM los reyes magos y, no perderé un minuto más. Que sus majestades sean bondadosas y como mínimo os dejen por la mañana al lado en la cama a la persona favorita de vuestro corazón, que ya es MUCHISIMO.
Yo creo que tendré esa suerte...
¡Felices Reyes!

( este chorbete, de regalo para Mr. G, que le gustó ayer el chico de la bandurria y es él mismo, pero en plan más guerrillero...¡guau!...¡guau-guau-guau!...¡guaugauguaguauguguauguauuuu! )

miércoles, enero 04, 2012


Un año más, el que SS.MM. los reyes de oriente no den abasto para atender sus múltiples obligaciones planetarias y los adultos debamos andar parcheando los huecos que les quedan en sus menesteres, es una pesadilla. Provoca estrés, acelerones, empujones, conlleva aguantar colas, armarse de paciencia y conformarse con las sobras en todas las tiendas porque, un año más, lo dejaste todo para el final, y un año más vuelves a lamentarte de lo mismo.

Peeero, así es la vida o así es mi vida al menos, como si cabalgase la pata-que-pinta de un enorme compás que traza círculos y cada año me deja en el mismo sitio en donde estaba el año anterior.
En determinadas cosas, se agradece, porque la vida es tan incierta y hay tantas posibilidades de desgracia por ahí fuera que el poder revivir circunstancias, celebraciones y momentos en el mismo estado vital y con la misma gente querida en torno a uno pues es bueno, que caray. Me supongo que en la trayectoria vital de las personas todos andamos en la juventud trazando hermosas líneas discontinuas y zigzagueantes buscando algo pero sin saber exactamente qué, y llegado cierto momento todo el mundo cabalga su respectivo compás porque alcanza una situación en la que lo que se desea no es ir más lejos sino repetir la sencilla abundancia que nuestra vida nos proporciona, y dibujamos círculos como en un carrusel: un cielo azul con unas cuantas preciosas nubes blancas y nosotros ahí, dando vueltas con los pies colgando, aferrados a las cadenas para no caernos y sonriendo con el viento y el sol en la cara...

...cuanto más viejo me hago más pesado y filosófico me pongo, jeje. ¿Quien aguantará a este ángel con 70 u 80 tacos cuando además de lloriquear muchísimo por mis innumerables achaques me de por ponerme profundo e introspectivo?...¡yo no , jajaja!

Total, que esta mañana he madrugado a pesar de mi nocturnidad, y la verdad es que en un par de horas me he ventilado casi toda la papeleta regalística. Eso se merece un número musical y NO, no hace falta que os sintais culpables por NO ver el video que adjunto como sé positivamente que todos haceis -yo casi nunca me veo el video que me sugiere quien sea que me lo sugiera en donde sea que me lo sugiera así que ya me sé el percal, esto es como lo de haber sido cocinero antes de fraile he-he-he- porque el PEDAZO de chorbo que voy a plantificar aquí es una imagen estática de las de mirar en silencio y decir "cojona que rico está este pollo", haaa-haaa-haaa...así que nada, ahí os dejo con Benjamín ( así se llama este chico, que se parece a UN ACTOR famoso pero no recuerdo cual...¿alguno apellidado Baldwin? ), y que os sea leve la maratoniana víspera de reyes, guapetes...

PD:...he tenido que buscar y justo a este de los cinematográficos hermanos Baldwin se parece. Que no es Stephen B., ni Alec B., es William...¿a que se parece un huevo?...

martes, enero 03, 2012

DIARO NAVIDEÑO: SUPLEMENTO A LA ENTRADA DEL DÍA - JACK-LOST que esta a mi Mr. G le va a encantaaaaaaar...


Hoy estoy para pocos cachondeos, me costó un mundo levantarme de la cama al mediodía tras la noche de trabajo y el resto de la jornada, sin ninguna cosa en concreto a la que echar la culpa, me ha sentado como me suelen sentar los primeros días de Enero: como una patada en el orrrrrrto, jeje. Tendré que esperar a mi pequeño momento Mr.G del final del día para poder darle un poco de color y calidez a la jornada. Porque el tiempo con él, sea como sea y se emplee en la manera en que se emplee, siempre me hace sentir de una forma u otra y es una especie de pellizco en mi flanco adormilado que me recuerda que estoy vivo. que a veces entro en piloto automático y se me olvida un poco...

...y el título de hoy viene a cuento de esta canción poco navideña que lleva ya mucho tiempo rodando por las radiofórmulas, no voy a descubrir la pólvora a nadie, pero que yo antes no había escuchado demasiado concentrado como siempre en lo último de Britney y cosas así. Y aparte de que la melodía es poderosa y el  mensaje apasionado y desolador a la vez ( mas o menos "¿porqué pudiendo tenerlo todo, lo mandamos todo al carajo?"), pues es que me encanta el video: la superficie de ese millar de vasos llenos de agua que empieza a vibrar dibujando círculos concéntricos cuando la base rítmica del tema empieza a sonar, y ese danzante diabólico arrancando pasos de baile a la arena que está bajo sus pies...¡tremendo! Hasta ahora no logré conectar musicalmente con Adele porque a pesar de su fuerza y perfección vocal, la encontraba heladora en su fondo,  quizás porque lo que ella musicalmente puede transmitir en este momento de su experiencia vital es así, oscuro y frío. Pero no sé si será el llegar Enero que se me hace siempre así, oscuro y frío, por lo que de pronto le estoy dando una oportunidad a su album "21" y me estoy sintiendo mucho más cómodo entre sus brazos ( sonoros ).

Con el frío, la humedad y la niebla que encadenan amaneceres y anocheceres ahí fuera casi sin transción, me apetece ella, con su voz que rasga la penumbra de este invierno como un relámpago azulado...

...valevalevale, y como no vamos a dejarlo así por no dar como rollo chuchurrío, he aquí a Mr. Chris Rockway, que como es muy amigo de Mr. G., le alegrará verle de nuevo aunque sea en plan tan formalito:

lunes, enero 02, 2012


...aquí le tenemos, un nuevo año amaneciendo fuerte y furioso como amanecen las cosas que saben que por mucho que la gente se empeñe, van a suceder sí o sí...

...y ahí estás tú recibiendo el ritmo cotidiano como se recibe un jarro de agua fría en pleno rostro para despertar de un plácido sueño...otra vez a vivir deprisa y caminar rápido para descubrir cuando termina el día que estás en el mismo sitio que cuando te has levantado...

...y, yo lo sé, puede que te sientas solo en medio de todo el barullo...

...que necesites un poco de armonía...

...incluso un poco de amor...

...pues estas son las razones por las que este diario navideño ha decidido prolongar su clausura ¡hasta después del día de los Reyes Magos! Para que tu, cachorrillo/a lector/a no te enfrentes solito a la despiadada y fría crueldad de la vida cotidiana.
Por ello y para colaborar a la transmisión de conocimiento, arte y creatividad juvenil, obras de arte independiente y qué-sé-yo-qué-pistos más, adjunto este vídeo cuyo descubrimiento no me adjudico pero que vaya, cuando presenciéis esta muestra de solidaridad y sacrificio entre muchachas adolescentes no solo aceptareis mejor vuestra coyuntura personal si no que recuperareis la fe en el género humano y además repetiréis el visionado del escaso minuto y medio porque no habréis dado crédito a vuestras pupilas.
El género creo que viene a ser como trance-rap.
Feliz año, afición!!!

Después de poner esto ( más que nada para tenerlo localizado y poder verlo cuando yo quiera para carcajearme un rato ) creo que me puedo permitir hasta poner un hombre semidesnudo porque ya he reventao la línea sensible inicial. 
Así que toma del frasco y a terminar bien el primer fucking-monday del año, ha-ha-ha...


El último mar que compartimos juntos

El último mar que compartimos juntos
...esta vez, solo contigo